SRX14961750: Solanum chacoense, M6, open flower, replicate 1, 2, 3, CHA_AP_01_ONT, Oxford Nanopore Technologies PCR-cDNA Barcoding Kit SQK-PCB109 (BP03 GAGTCTTGTGTCCCAGTTACCAGG)
1 OXFORD_NANOPORE (MinION) run: 0 spots, 0 bases
Design: Oxford Nanopore Technologies PCR-cDNA Barcoding Kit SQK-PCB109, index BP03 GAGTCTTGTGTCCCAGTTACCAGG
Submitted by: University of Georgia
Study:
Sequence and assembly of the wild potato species, Solanum chacoense M6Library:
Name: CHA_AP_01_ONT
Instrument: MinION
Strategy: RNA-Seq
Source: TRANSCRIPTOMIC
Selection: RANDOM
Layout: SINGLE